Ad
related to: primer3 designFree online tool to design primers for PCR & sequencing. Design the perfect primers for your PCR, CE sequencing and cloning.
- Oligo Calculator
Calculate final oligo volume.
Percentage of full-length oligo?
- Order Oligos
Tube or plate; Dry or in solution.
Design and buy custom Oligos.
- Primer Design Tips
Important factors for designing.
For successful PCR reaction.
- Technical Resources
Protocols, storage & quality info.
Access technical support.
- Oligos FAQ
Questions about Oligos?
Get your Oligos questions answered.
- OEM Services & Support
OEM and flexible packaging
Custom commercialization offerings
- Oligo Calculator
Search results
5 days ago · Our primer design took into account various factors, including melting temperature, self-complementarity, hairpin potential, and primer product sizes. ... Untergasser, A. et al. Primer3–new ...
4 days ago · The Primer design tool on ANAgdb, powered by the primer3 core program , enhances user experimentation by facilitating web-based PCR primer design (Fig. 4E). This interface offers traditional primer design functions along with innovative features convenient for genetic experiments.
3 days ago · Process like DNA sequencing (to determine the exact order of nucleotides in a DNA) and polymerase chain reaction (or PCR, used to amplify DNA sequences) require DNA primers whereas for natural DNA replication short sequences of RNA is used as primer. Usually the length of the primer is 18 to 24 nucleotides.
4 days ago · The presence of conservative single-copy sequences showing polymorphism at both ends of the SSRs enables efficient designing of primers according to the flanking sequences (Guo et al., 2022). Microsatellites account for ~1 % of the genome in most sequenced species and occur throughout the genome, including mitochondria and chloroplast ( Zhang ...
5 days ago · The CCDC88A primer design was developed using Primer3web version 4.1.0 (https://primer3.ut.ee/). One primer set (forward − 5’AGTTTTCCTCATCAAGTTGGGA3’ and reverse − 5’AGGAGAACGAGCTGAAGAACT3’) amplified a 242 bp fragment targeting the p.Ile648Ter variant; the other set (forward − 5’TCCAGTTGCCTCTCCTAACA3’, and reverse − 5 ...
2 days ago · Helichrysum italicum (Roth) G. Don is a Mediterranean medicinal plant with great potential in the cosmetics, culinary and pharmaceutical fields due to its unique bioactive compounds. Its recent introduction into agroecosystems has enhanced the exploitation of genetic diversity in natural populations, although limited molecular markers have made this challenging. In the present study, primers ...
5 days ago · 2.1. Design. The present in vitro investigation was conducted on viable protoscoleces (PSCs) of the sheep strain of E. granulosus, subsequent to obtaining protocol approval from the local Institutional Review Board (IRB). Additionally, efforts were made to minimize the number of animals utilized, ensuring only the necessary quantity to achieve ...